WormBase Tree Display for Variation: WBVar00600869
expand all nodes | collapse all nodes | view schema
WBVar00600869 | Name | Public_name | tm5487 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T21C12.1c.2:c.936_1128+58del | |||||||
T21C12.1d.1:c.936_1128+58del | ||||||||
T21C12.1e.1:c.936_1129-18del | ||||||||
T21C12.1k.1:c.936_1128+58del | ||||||||
T21C12.1f.1:c.563-1993_563-1692del | ||||||||
T21C12.1c.1:c.936_1128+58del | ||||||||
T21C12.1m.1:c.432_624+58del | ||||||||
T21C12.1o.1:c.59-1993_59-1692del | ||||||||
HGVSg | CHROMOSOME_III:g.10528593_10528894del | |||||||
Sequence_details | SMap | S_parent | Sequence | T21C12 | ||||
Flanking_sequences | aaccaataattcgatgccaaaagtgtctta | aacacattcttatttagtcatacgaaatga | ||||||
Mapping_target | T21C12 | |||||||
Source_location | 7 | CHROMOSOME_III | 10528592 | 10528895 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm5487_external | |||||||
tm5487_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 5487 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006784 | ||||||
Transcript | T21C12.1k.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T21C12.1k.1:c.936_1128+58del | |||||||
cDNA_position | 936-? | |||||||
CDS_position | 936-? | |||||||
Protein_position | 312-? | |||||||
Intron_number | 7-8/11 | |||||||
Exon_number | 7-8/12 | |||||||
T21C12.1m.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T21C12.1m.1:c.432_624+58del | |||||||
cDNA_position | 432-? | |||||||
CDS_position | 432-? | |||||||
Protein_position | 144-? | |||||||
Intron_number | 3-4/8 | |||||||
Exon_number | 3-4/9 | |||||||
T21C12.1c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T21C12.1c.1:c.936_1128+58del | |||||||
cDNA_position | 1142-? | |||||||
CDS_position | 936-? | |||||||
Protein_position | 312-? | |||||||
Intron_number | 8-9/18 | |||||||
Exon_number | 8-9/19 | |||||||
T21C12.1e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T21C12.1e.1:c.936_1129-18del | |||||||
cDNA_position | 1061-? | |||||||
CDS_position | 936-? | |||||||
Protein_position | 312-? | |||||||
Intron_number | 8-9/19 | |||||||
Exon_number | 8-9/20 | |||||||
T21C12.1c.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T21C12.1c.2:c.936_1128+58del | |||||||
cDNA_position | 1061-? | |||||||
CDS_position | 936-? | |||||||
Protein_position | 312-? | |||||||
Intron_number | 8-9/14 | |||||||
Exon_number | 8-9/15 | |||||||
T21C12.1o.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | T21C12.1o.1:c.59-1993_59-1692del | |||||||
Intron_number | 1/5 | |||||||
T21C12.1d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T21C12.1d.1:c.936_1128+58del | |||||||
cDNA_position | 1142-? | |||||||
CDS_position | 936-? | |||||||
Protein_position | 312-? | |||||||
Intron_number | 8-9/17 | |||||||
Exon_number | 8-9/18 | |||||||
T21C12.1f.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | T21C12.1f.1:c.563-1993_563-1692del | |||||||
Intron_number | 6/11 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 7917/7918-8219/8220 (302 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |