WormBase Tree Display for Variation: WBVar00600877
expand all nodes | collapse all nodes | view schema
WBVar00600877 | Name | Public_name | tm5503 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | H27M09.1.1:c.168+3_537del | |||||||
HGVSg | CHROMOSOME_I:g.6851551_6852169del | |||||||
Sequence_details | SMap | S_parent | Sequence | H27M09 | ||||
Flanking_sequences | gactgcattacagagaaaacgagaaaaagt | gaaggtgatcatattccaccgccaatcggc | ||||||
Mapping_target | H27M09 | |||||||
Source_location | 7 | CHROMOSOME_I | 6851550 | 6852170 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm5503_external | |||||||
tm5503_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005694 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 5503 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00019245 | ||||||
Transcript | H27M09.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | H27M09.1.1:c.168+3_537del | |||||||
cDNA_position | ?-546 | |||||||
CDS_position | ?-537 | |||||||
Protein_position | ?-179 | |||||||
Intron_number | 2-4/13 | |||||||
Exon_number | 3-5/14 | |||||||
Interactor (13) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00041364 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Upon mating, sacy-1(tm5503) females produce embryos that arrest without properly undergoing morphogenesis and fail to hatch. | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00041364 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
an analysis of the strong loss-of-function sacy-1(tm5503) allele (Figure 4A) shows it to be an essential gene with a zygotic sterile phenotype | Paper_evidence | WBPaper00041364 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00041364 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Homozygous hermaphrodites produced from heterozygous parents develop to adulthood but are sterile. | Paper_evidence | WBPaper00041364 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Rescued_by_transgene | WBTransgene00015492 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000692 | Paper_evidence | WBPaper00041364 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | sacy-1(tm5503) adult males were never observed to sire cross-progeny. | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001675 | Paper_evidence | WBPaper00041364 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | sacy-1(tm5503) adult hermaphrodites do not produce fertilized embryos (Table 4); instead they contain oocytes and sperm that become vacuolated and appear to degenerate. We also observed a similar sperm degeneration phenotype in sacy-1(tm5503) adult males (Figure 7A), which were never observed to sire cross-progeny. | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002260 | Paper_evidence | WBPaper00041364 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | sacy-1(tm5503) adult hermaphrodites do not produce fertilized embryos (Table 4); instead they contain oocytes and sperm that become vacuolated and appear to degenerate. We observed that acridine orange stains early degenerating gametes in the proximal gonad of sacy-1(tm5503) single mutant hermaphrodites. We did not observe mating to wild-type males to overtly increase the penetrance or severity of oocyte degeneration. | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000399 | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The somatic gonad appeared to develop normally in sacy-1(tm5503) hermaphrodites. | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002188 | Paper_evidence | WBPaper00041364 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The somatic gonad appeared to develop normally in sacy-1(tm5503) males. | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00041364 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00041364 | |||||||
Remark | 9477/9478-10096/10097 (619 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |