WormBase Tree Display for Variation: WBVar00600925

WBVar00600925 Name: Public_name: tm5530
    Other_name (11)
    HGVSg: CHROMOSOME_I:g.7447014_7447441delinsT
  Sequence_details: SMap: S_parent: Sequence: ZK524
    Flanking_sequences: tagatgaagaagttaaacttccaaaagttc agtgtttttttctcatggaaatgtgatact
    Mapping_target: ZK524
    Source_location: 7 CHROMOSOME_I 7447013 7447442 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: T
      Deletion
    PCR_product: tm5530_external
      tm5530_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5530
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006752
    Transcript (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 11295/11296-T-11723/11724 (428 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele