WormBase Tree Display for Variation: WBVar00601007

WBVar00601007 Name: Public_name: tm5551
    Other_name: F08B6.4a.1:c.661_1127del
      F08B6.4b.1:c.88_554del
      CE20658:p.Val222GlufsTer6
      CE27922:p.Val31GlufsTer6
    HGVSg: CHROMOSOME_I:g.6763780_6764743del
  Sequence_details: SMap: S_parent: Sequence: F08B6
    Flanking_sequences: agtggaatttcagattgatctggtttctcg ctttggctgaccttgtccggtgactttggt
    Mapping_target: F08B6
    Source_location: 7 CHROMOSOME_I 6763779 6764744 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5551_external
      tm5551_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5551
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006819
    Transcript: F08B6.4b.1 (11)
      F08B6.4a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 9118/9119-10082/10083 (964 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele