WormBase Tree Display for Variation: WBVar00601254

WBVar00601254 Evidence: Paper_evidence: WBPaper00040335
  Name: Public_name: tr185
    Other_name: F53B6.2a.1:c.1052+1918G>A
      F53B6.2b.1:c.3G>A
      F53B6.2c.1:c.1046+1918G>A
      CE32429:p.Met1?
    HGVSg: CHROMOSOME_I:g.8937551C>T
  Sequence_details: SMap: S_parent: Sequence: F53B6
    Flanking_sequences: gaagatctggatacaggttttggaattttggaacttgagcacaat ctccccctactcctgattttatcagcaccattgggtgtcagtgct
    Mapping_target: F53B6
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00040335
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: RP
    Status: Live
  Affects: Gene: WBGene00009958
    Transcript: F53B6.2c.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F53B6.2c.1:c.1046+1918G>A
        Intron_number: 8/17
      F53B6.2a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F53B6.2a.1:c.1052+1918G>A
        Intron_number: 9/18
      F53B6.2b.1 (12)
  Genetics: Interpolated_map_position: I 3.3266
  Description: Phenotype: WBPhenotype:0001930 Paper_evidence: WBPaper00040335
        Curator_confirmed: WBPerson7190
        Remark: Animals extend fewer muscle arms towards the dorsal nerve cord compared to the ventral nerve cord Paper_evidence: WBPaper00040335
            Curator_confirmed: WBPerson7190
  Reference: WBPaper00040335
  Remark: Updated the flanking sequences to be on the correct ATG and Isoform reported in the paper.
  Method: Substitution_allele