WormBase Tree Display for Variation: WBVar01429526
expand all nodes | collapse all nodes | view schema
WBVar01429526 | Name | Public_name | tm5409 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F46B6.3a.1:c.442_727delinsGGGGAGAAGCAGGACGCAAATTCGGAAACTTG | |||||||
CE30440:p.Asn148GlyfsTer31 | ||||||||
F46B6.3b.1:c.442_727delinsGGGGAGAAGCAGGACGCAAATTCGGAAACTTG | ||||||||
CE26973:p.Asn148GlyfsTer31 | ||||||||
HGVSg | CHROMOSOME_V:g.9776911_9777248delinsCAAGTTTCCGAATTTGCGTCCTGCTTCTCCCC | |||||||
Sequence_details | SMap | S_parent | Sequence | F46B6 | ||||
Flanking_sequences | gttcttttctttttgcgtcctgcttctccc | aagtttccgaatttgttgttccagagtcag | ||||||
Mapping_target | F46B6 | |||||||
Source_location | 7 | CHROMOSOME_V | 9776910 | 9777249 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | CAAGTTTCCGAATTTGCGTCCTGCTTCTCCCC | ||||||
Deletion | ||||||||
PCR_product | tm5409_external | |||||||
tm5409_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 5409 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004882 | ||||||
Transcript | F46B6.3b.1 (11) | |||||||
F46B6.3a.1 (11) | ||||||||
Interactor | WBInteraction000536770 | |||||||
WBInteraction000536774 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype | WBPhenotype:0000030 | Paper_evidence | WBPaper00041065 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "The smg-1, smg-4, and smg-6 mutants exhibited synthetic growth defects upon silencing of ire-1 (Fig. S7)." | Paper_evidence | WBPaper00041065 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | ire-1(RNAi) | Paper_evidence | WBPaper00041065 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00041065 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "To assess whether ER protein-folding homeostasis requires NMD-mediated mRNA surveillance, we analyzed deletions of the NMD genes smg-1, smg-4, and smg-6 in the zcIs4 transgenic hsp-4 GFP reporter strain. All strains displayed greater GFP fluorescence compared the parental zcIs4 strain (Fig. 2A and Fig. S6), and qRT-PCR revealed that the expression of endogenous hsp-4 mRNA was constitutively elevated in the smg-1(tm849) and smg-6(ok1794) mutant strains compared the wild type N2 (Fig. 2B)." | Paper_evidence | WBPaper00041065 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | zcIs4 [Phsp-4::GFP] | Paper_evidence | WBPaper00041065 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001485 | Paper_evidence | WBPaper00041065 | ||||||
Curator_confirmed | WBPerson4260 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00041065 | |||||||
Remark | 7939/7940-CAAGTTTCCGAATTTGCGTCCTGCTTCTCCCC-8277/8278 (338 bp deletion + 32 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |