WormBase Tree Display for Variation: WBVar01429653
expand all nodes | collapse all nodes | view schema
WBVar01429653 | Evidence | Paper_evidence | WBPaper00041328 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | F43G9 | |||
Flanking_sequences | gatgcccaaacaccttgatgatctgttgta | cttcttctgtcaagtgcgtatacttggttc | |||||
Mapping_target | F43G9 | ||||||
Type_of_mutation | Substitution | t | a | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | MT | ||||||
Status | Live | ||||||
Linked_to | WBVar02147198 | ||||||
Affects | Gene | WBGene00009671 | |||||
Transcript | F43G9.10.1 (12) | ||||||
Genetics | Interpolated_map_position | I | 3.0135 | ||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00041328 | |||
Curator_confirmed | WBPerson2495 | ||||||
Reference | WBPaper00041328 | ||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |