WormBase Tree Display for Variation: WBVar01473944
expand all nodes | collapse all nodes | view schema
WBVar01473944 | Name | Public_name | yb1697 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C17D12.2b.1:c.200-1G>A | |||||||
C17D12.2a.1:c.200-1G>A | ||||||||
HGVSg | CHROMOSOME_I:g.11594209G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C17D12 | ||||
Flanking_sequences | cacggttcattagaaattgaaatgcattca | GTATGCACAAAGGCTGCGCATTTCTCACCT | ||||||
Mapping_target | C17D12 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (4) | ||||||||
Affects | Gene | WBGene00305276 | ||||||
WBGene00006807 | ||||||||
Transcript | C17D12.2b.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C17D12.2b.1:c.200-1G>A | |||||||
Intron_number | 2/7 | |||||||
C17D12.20 | ||||||||
C17D12.2a.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C17D12.2a.1:c.200-1G>A | |||||||
Intron_number | 3/10 | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | I | 9.27986 | |||||
Description | Phenotype | WBPhenotype:0000643 | Person_evidence | WBPerson1686 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Unc | Person_evidence | WBPerson1686 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Person_evidence | WBPerson1686 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Person_evidence | WBPerson1686 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | KH1697 unc-75 (yb1695) I; ybIs1622 [rgef-1::unc-32E7a-EGFP rgef-1::unc-32E7b-mRFP lin-15(+)]/+ | Person_evidence | WBPerson1686 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002119 | Person_evidence | WBPerson1686 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The ybIs1622 unc-32 exon 7 alternative splicing reporter expresses Green in the wild-type background but Red/Green in this mutant. | Person_evidence | WBPerson1686 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Person_evidence | WBPerson1686 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Person_evidence | WBPerson1686 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | KH1697 unc-75 (yb1695) I; ybIs1622 [rgef-1::unc-32E7a-EGFP rgef-1::unc-32E7b-mRFP lin-15(+)]/+ | Person_evidence | WBPerson1686 | ||||
Curator_confirmed | WBPerson712 | |||||||
Method | Substitution_allele |