WormBase Tree Display for Variation: WBVar01473946
expand all nodes | collapse all nodes | view schema
WBVar01473946 | Evidence | Paper_evidence | WBPaper00041718 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | bx142 | |||||||
Other_name (13) | |||||||||
HGVSg | CHROMOSOME_III:g.6635245C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C13B9 | |||||
Flanking_sequences | aattgttaccctatttcattgctggatacg | taacgtttttaataaattttgaacaactta | |||||||
Mapping_target | C13B9 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00041718 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007196 | ||||||||
Laboratory | EM | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00015735 | |||||||
Transcript | C13B9.4d.3 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4d.3:c.862+1G>A | ||||||||
Intron_number | 9/14 | ||||||||
C13B9.4c.3 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4c.3:c.892+1G>A | ||||||||
Intron_number | 9/15 | ||||||||
C13B9.4b.3 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4b.3:c.862+1G>A | ||||||||
Intron_number | 12/18 | ||||||||
C13B9.4a.2 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4a.2:c.892+1G>A | ||||||||
Intron_number | 12/18 | ||||||||
C13B9.4e.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4e.1:c.862+1G>A | ||||||||
Intron_number | 10/15 | ||||||||
C13B9.4a.3 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4a.3:c.892+1G>A | ||||||||
Intron_number | 9/15 | ||||||||
C13B9.4c.2 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4c.2:c.892+1G>A | ||||||||
Intron_number | 12/18 | ||||||||
C13B9.4b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4b.1:c.862+1G>A | ||||||||
Intron_number | 10/16 | ||||||||
C13B9.4c.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4c.1:c.892+1G>A | ||||||||
Intron_number | 10/16 | ||||||||
C13B9.4d.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4d.1:c.862+1G>A | ||||||||
Intron_number | 10/16 | ||||||||
C13B9.4a.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4a.1:c.892+1G>A | ||||||||
Intron_number | 10/16 | ||||||||
C13B9.4d.2 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4d.2:c.862+1G>A | ||||||||
Intron_number | 9/15 | ||||||||
C13B9.4b.2 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C13B9.4b.2:c.862+1G>A | ||||||||
Intron_number | 9/15 | ||||||||
Interactor | WBInteraction000519220 | ||||||||
Genetics | Interpolated_map_position | III | -1.02797 | ||||||
Description | Phenotype | WBPhenotype:0000551 | Paper_evidence | WBPaper00041718 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pdfr-1 mutants produced an increase in the frequency of high-angle turns (omega turns) compared with wild-type males. | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001482 | Paper_evidence | WBPaper00041718 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pdfr-1 mutant males displayed a decrease in the frequency of body bends (propagation of the sinusoidal wave). | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001506 | Paper_evidence | WBPaper00041718 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pdfr-1 mutants produced an increase in the frequency of reversals compared with wild-type males. | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00041718 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pdfr-1 mutants underwent behavioral quiescence in nutritionally high food. | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002128 | Paper_evidence | WBPaper00041718 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant males remain on food in the absence of mates. Males had no drive to explore away from food. | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00016274 | ||||||||
WBTransgene00016276 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0005346 | PATO:0000460 | Paper_evidence | WBPaper00041718 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004096 | PATO:0000460 | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0007807 | PATO:0000460 | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006973 | PATO:0000460 | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00041718 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002130 | Paper_evidence | WBPaper00041718 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00041718 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants were able to successfully mate, although they did not respond as avidly as wild-type males to mate contact. | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004028 | Paper_evidence | WBPaper00041718 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pdfr-1 mutant males displayed slow movement on food as a result of a decrease in the frequency of body bends. | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pdfr-1 mutant males were able to travel the scoring distance of the leaving assay plate (3.5-cm radius) at a rate similar to that of wild-type males if the area was covered with food. | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001072 | Paper_evidence | WBPaper00041718 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Although pdfr-1 mutant males displayed higher absolute levels of reversals than wild-type males, reversals decreased twofold by 30 min after the last food exposure, as in wild-type males. | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00041718 | ||||||||
Method | Substitution_allele |