WormBase Tree Display for Variation: WBVar02120489
expand all nodes | collapse all nodes | view schema
WBVar02120489 | Name | Public_name | WBVar02120489 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851412 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | AGTATTCATGAGCTCCTGCACTTGGATAAC | ACCGCCCATCGATCGGATTCGCCGTTCCCA | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 225 | CHROMOSOME_III | 13236001 | 13255000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000032 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00006629 | From_analysis | Million_mutation_project_reanalysis | ||||||
WBStrain00006631 | From_analysis | Million_mutation_project_reanalysis | ||||||
WBStrain00006637 | From_analysis | Million_mutation_project_reanalysis | ||||||
WBStrain00023072 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00010138 | ||||||
WBGene00012798 | ||||||||
WBGene00185001 | ||||||||
WBGene00012799 | ||||||||
Transcript | F56A8.1a.1 | |||||||
F56A8.1b.1 | ||||||||
Y43F4A.3.1 | ||||||||
F56A8.9.1 | ||||||||
Y43F4A.4.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |