WormBase Tree Display for Variation: WBVar02120977
expand all nodes | collapse all nodes | view schema
WBVar02120977 | Name | Public_name | WBVar02120977 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851900 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | AATCTATGTGACCAGGGGTATGCGACTCTG | TATGCCTAATTTGTTGACACGTCAGCTAAT | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 225 | CHROMOSOME_III | 932697 | 946914 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004600 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (6) | |||||||
Transcript | T12B5.6c.1 | |||||||
T12B5.8.2 | ||||||||
T12B5.7.1 | ||||||||
T12B5.10.1 | ||||||||
T12B5.6b.1 | ||||||||
T12B5.8.1 | ||||||||
T12B5.5.1 | ||||||||
Pseudogene | T12B5.9 | |||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |