WormBase Tree Display for Variation: WBVar02121413
expand all nodes | collapse all nodes | view schema
WBVar02121413 | Name (2) | |||||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | GGAATGACGACAGAGATGCATTACAATATC | TAAAGGTCACTGGTTCGTTCCCCACTTGGT | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 225 | CHROMOSOME_III | 7585001 | 7598000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006622 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00305069 | ||||||
WBGene00020053 | ||||||||
WBGene00000846 | ||||||||
WBGene00194726 | ||||||||
Transcript | R13A5.15.1 | |||||||
R13A5.1d.1 | ||||||||
R13A5.1c.1 | ||||||||
Y80D4G.2.1 | ||||||||
R13A5.1a.1 | ||||||||
R13A5.11.1 | ||||||||
R13A5.1e.1 | ||||||||
R13A5.1b.1 | ||||||||
R13A5.1a.2 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |