WormBase Tree Display for Variation: WBVar02121754
expand all nodes | collapse all nodes | view schema
WBVar02121754 | Name | Public_name | WBVar02121754 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00852677 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | AATGAATGAGTCAAGTGTTCTTATTGAATT | CTCTTTAGAAAAAAAGGTCGGTATTTTCAG | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 225 | CHROMOSOME_III | 7164001 | 7181000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006629 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00018151 | ||||||
WBGene00004483 | ||||||||
WBGene00005074 | ||||||||
WBGene00018152 | ||||||||
WBGene00019400 | ||||||||
WBGene00004450 | ||||||||
WBGene00005073 | ||||||||
WBGene00005072 | ||||||||
Transcript | F37C12.7.1 | |||||||
K04G7.1.1 | ||||||||
F37C12.4.1 | ||||||||
F37C12.3.1 | ||||||||
F37C12.9.1 | ||||||||
Pseudogene (3) | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |