WormBase Tree Display for Variation: WBVar02123283
expand all nodes | collapse all nodes | view schema
WBVar02123283 | Name | Public_name | WBVar02123283 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854206 | |||||||
Sequence_details | SMap | S_parent | Sequence | W08A12 | ||||
Flanking_sequences | GACTTGCCGGTTTGCCAATTTGCCGGAAAT | TTTTAATTCCAAAAAAGTGGCAAAAACTGA | ||||||
Mapping_target | W08A12 | |||||||
Source_location | 225 | CHROMOSOME_V | 3699153 | 3699299 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022850 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00022930 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00021078 | ||||||
Transcript | W08A12.1a.1 | |||||||
W08A12.1b.3 | ||||||||
W08A12.1b.2 | ||||||||
W08A12.1c.1 | ||||||||
W08A12.1b.1 | ||||||||
W08A12.1d.1 | ||||||||
W08A12.1e.1 | ||||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |