WormBase Tree Display for Variation: WBVar02123329
expand all nodes | collapse all nodes | view schema
| WBVar02123329 | Name | Public_name | WBVar02123329 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | cewivar00854252 | |||||||
| Sequence_details | SMap | S_parent | Sequence | C15C7 | ||||
| Flanking_sequences | TTTCAATTCCTAACTAAAAGCTCACTTCAT | TACAAGCAGAAAGACAGAAACTTGCGTTAT | ||||||
| Mapping_target | C15C7 | |||||||
| Source_location | 225 | CHROMOSOME_X | 3159301 | 3159976 | From_analysis | Million_mutation_project_reanalysis | ||
| Type_of_mutation | Tandem_duplication | |||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Natural_variant | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00022850 | From_analysis | Million_mutation_project_reanalysis | |||||
| Laboratory | VC | |||||||
| Analysis | Million_mutation_project_reanalysis | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00201126 | ||||||
| WBGene00002220 | ||||||||
| Transcript | C15C7.12 | |||||||
| C15C7.2.1 | ||||||||
| Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
| Method | WGS_Flibotte |
