WormBase Tree Display for Variation: WBVar02123378
expand all nodes | collapse all nodes | view schema
WBVar02123378 | Name | Public_name | WBVar02123378 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854301 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | AAAAAGGCACATTTTTCTTTAAATACTTTT | TAGCGTTTTAGCATTTAGTAACGGAAGGAT | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 225 | CHROMOSOME_III | 1241001 | 1273000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022852 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (14) | |||||||
Transcript (13) | ||||||||
Pseudogene | Y119D3B.20 | |||||||
Y119D3B.5 | ||||||||
Y119D3B.18 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |