WormBase Tree Display for Variation: WBVar02123379

WBVar02123379 Name: Public_name: WBVar02123379
    Other_name: cewivar00854302
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_III
    Flanking_sequences: AATTGAAACGAGAATATAAAGAGATATTAA GGTGAGATGTGGGAAAAAGTGCTCCGGCTT
    Mapping_target: CHROMOSOME_III
    Source_location: 225 CHROMOSOME_III 1347001 1414000 From_analysis: Million_mutation_project_reanalysis
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Natural_variant
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00022852 From_analysis: Million_mutation_project_reanalysis
    Laboratory: VC
    Analysis: Million_mutation_project_reanalysis
    Status: Live
  Affects: Gene (24)
    Transcript (28)
    Pseudogene: Y82E9BL.2
      Y82E9BR.7
  Remark: The boundaries of this variant have been identified only approximately
    This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous
  Method: WGS_Flibotte