WormBase Tree Display for Variation: WBVar02124688
expand all nodes | collapse all nodes | view schema
WBVar02124688 | Name | Public_name | WBVar02124688 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855611 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | GATTTTTCGGAACATTTATCGATTTTTCAG | ACAATTCTAAGACCAAAAATGACTCGAAAA | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 225 | CHROMOSOME_III | 2961001 | 2976000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027662 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00019157 | ||||||
WBGene00019159 | ||||||||
WBGene00195489 | ||||||||
WBGene00021917 | ||||||||
WBGene00019158 | ||||||||
Transcript | Y55D5A.8 | |||||||
Y55D5A.3.1 | ||||||||
H05C05.2b.1 | ||||||||
H05C05.1a.1 | ||||||||
H05C05.2a.1 | ||||||||
Pseudogene | H05C05.3 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |