WormBase Tree Display for Variation: WBVar02144112
expand all nodes | collapse all nodes | view schema
WBVar02144112 | Evidence (2) | ||||||
---|---|---|---|---|---|---|---|
Name | Public_name | e3016 | |||||
Other_name | BE10.2.2:c.372G>T | ||||||
BE10.2.1:c.372G>T | |||||||
CE30592:p.Cys124= | |||||||
HGVSg | CHROMOSOME_III:g.12797447C>A | ||||||
Sequence_details | SMap | S_parent | Sequence | BE10 | |||
Flanking_sequences | CAGGCAAAAAATCCATGTCCACGGGGAATC | CATGGAAGTTCTAATATTCGCCAGTTATCC | |||||
Mapping_target | BE10 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00046585 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00024123 | ||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00007210 | |||||
Transcript | BE10.2.2 | VEP_consequence | synonymous_variant | ||||
VEP_impact | LOW | ||||||
HGVSc | BE10.2.2:c.372G>T | ||||||
HGVSp | CE30592:p.Cys124= | ||||||
cDNA_position | 532 | ||||||
CDS_position | 372 | ||||||
Protein_position | 124 | ||||||
Exon_number | 5/11 | ||||||
Codon_change | tgC/tgT | ||||||
Amino_acid_change | C | ||||||
BE10.2.1 | VEP_consequence | synonymous_variant | |||||
VEP_impact | LOW | ||||||
HGVSc | BE10.2.1:c.372G>T | ||||||
HGVSp | CE30592:p.Cys124= | ||||||
cDNA_position | 410 | ||||||
CDS_position | 372 | ||||||
Protein_position | 124 | ||||||
Exon_number | 4/10 | ||||||
Codon_change | tgC/tgT | ||||||
Amino_acid_change | C | ||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | III | 18.9767 | ||||
Description | Phenotype | WBPhenotype:0001918 | Paper_evidence | WBPaper00052991 | |||
Curator_confirmed | WBPerson38714 | ||||||
Reference | WBPaper00046585 | ||||||
WBPaper00052991 | |||||||
Remark | Corrected in WS291 based on correction received by email: "Please correct the mutation from WGG -> WGA at W130 to W124 -- it is exactly 18 bp upstream." | Person_evidence | WBPerson384 | ||||
Curator_confirmed | WBPerson51134 | ||||||
The e3016 mutation was reported as causing W130opal in Loer et al 2016, however this was inaccurate due to a change in WGS base numbering. This is the corrected change, as agreed with C. Loer and J. Hodgkin. | Person_evidence | WBPerson105 | |||||
Curator_confirmed | WBPerson51134 | ||||||
alt_det = TGG > TGA mut_det = causes W124opal | Person_evidence | WBPerson105 | |||||
Curator_confirmed | WBPerson51134 | ||||||
Variation information submitted by WBPerson105 on 2023-11-21_08:42:50 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||
Method | Substitution_allele |