WormBase Tree Display for Variation: WBVar02144112

WBVar02144112 Evidence: Paper_evidence: WBPaper00046585
    Person_evidence: WBPerson105
  Name: Public_name: e3016
    Other_name: BE10.2.2:c.372G>T
      BE10.2.1:c.372G>T
      CE30592:p.Cys124=
    HGVSg: CHROMOSOME_III:g.12797447C>A
  Sequence_details: SMap: S_parent: Sequence: BE10
    Flanking_sequences: CAGGCAAAAAATCCATGTCCACGGGGAATC CATGGAAGTTCTAATATTCGCCAGTTATCC
    Mapping_target: BE10
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00046585
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00024123
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00007210
    Transcript (2)
  Isolation: Mutagen: EMS
  Genetics: Interpolated_map_position: III 18.9767
  Description: Phenotype: WBPhenotype:0001918 Paper_evidence: WBPaper00052991
        Curator_confirmed: WBPerson38714
  Reference: WBPaper00046585
    WBPaper00052991
  Remark: Corrected in WS291 based on correction received by email: "Please correct the mutation from WGG -> WGA at W130 to W124 -- it is exactly 18 bp upstream." Person_evidence: WBPerson384
      Curator_confirmed: WBPerson51134
    The e3016 mutation was reported as causing W130opal in Loer et al 2016, however this was inaccurate due to a change in WGS base numbering. This is the corrected change, as agreed with C. Loer and J. Hodgkin. Person_evidence: WBPerson105
      Curator_confirmed: WBPerson51134
    alt_det = TGG > TGA mut_det = causes W124opal Person_evidence: WBPerson105
      Curator_confirmed: WBPerson51134
    Variation information submitted by WBPerson105 on 2023-11-21_08:42:50 via the Allele submission form. Curator_confirmed: WBPerson51134
  Method: Substitution_allele