WormBase Tree Display for Variation: WBVar02144821

WBVar02144821 Name: Public_name: tm7667
    Other_name: Y54G2A.57.1:c.32-154_32-64delinsA
      Y54G2A.25a.1:c.1429-602_1429-512delinsT
    HGVSg: CHROMOSOME_IV:g.2970372_2970462delinsA
  Sequence_details: SMap: S_parent: Sequence: Y54G2A
    Flanking_sequences: gcttgattttttgctaatggttttagacgt agtaaaaatttgggtttttttcgacaaacc
    Mapping_target: Y54G2A
    Source_location: 7 CHROMOSOME_IV 2970371 2970463 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: A
      Deletion
    PCR_product: tm7667_external
      tm7667_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 7667
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002243
      WBGene00189961
    Transcript: Y54G2A.25a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: Y54G2A.25a.1:c.1429-602_1429-512delinsT
        Intron_number: 10/23
      Y54G2A.57.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: Y54G2A.57.1:c.32-154_32-64delinsA
        Intron_number: 3/11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 220150/220151-A-220241/220242 (91 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele