WormBase Tree Display for Variation: WBVar02144836
expand all nodes | collapse all nodes | view schema
WBVar02144836 | Evidence | Paper_evidence | WBPaper00044649 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ky850 | |||||||
Other_name | CE17128:p.Gln27Ter | ||||||||
F57H12.7a.1:c.79C>T | |||||||||
HGVSg | CHROMOSOME_IV:g.7987074G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F57H12 | |||||
Flanking_sequences | cgtttggatcctatgagagttaagcaattg | agtaagtttttgatatattcacttagttta | |||||||
Mapping_target | F57H12 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00044649 | ||||
SeqStatus | Sequenced | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003178 | |||||||
Transcript | F57H12.7a.1 | VEP_consequence | stop_gained,splice_region_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F57H12.7a.1:c.79C>T | ||||||||
HGVSp | CE17128:p.Gln27Ter | ||||||||
cDNA_position | 110 | ||||||||
CDS_position | 79 | ||||||||
Protein_position | 27 | ||||||||
Exon_number | 2/7 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Genetics | Interpolated_map_position | IV | 3.5714 | ||||||
Description | Phenotype | WBPhenotype:0001224 | Paper_evidence | WBPaper00044649 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Outgrowth of ALM posterior neurite; outgrowth of PLM posterior neurite (Figure S1D,E) | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
EQ_annotations | Anatomy_term (2) | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00044649 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
WBPhenotype:0002364 | Paper_evidence | WBPaper00044649 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Figure 1B, D, E | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
Disease_info | Models_disease | DOID:1289 | |||||||
Models_disease_in_annotation | WBDOannot00000612 | ||||||||
Reference | WBPaper00044649 | ||||||||
Method | Substitution_allele |