WormBase Tree Display for Variation: WBVar02144879
expand all nodes | collapse all nodes | view schema
| WBVar02144879 | Evidence | Paper_evidence | WBPaper00048558 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | h2875 | |||||
| Other_name | CE33587:p.Phe21GlufsTer7 | ||||||
| Y18H1A.7a.1:c.61_124del | |||||||
| HGVSg | CHROMOSOME_I:g.719512_719575del | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y18H1A | |||
| Flanking_sequences | tcagacgagatagtagcagatcttcgccga | gaaattgctggaaagtgggaaaagctgaca | |||||
| Mapping_target | Y18H1A | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Engineered_allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | KR | ||||||
| Production_method | CRISPR_Cas9 | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004332 | |||||
| Transcript | Y18H1A.7a.1 | VEP_consequence | frameshift_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | Y18H1A.7a.1:c.61_124del | ||||||
| HGVSp | CE33587:p.Phe21GlufsTer7 | ||||||
| cDNA_position | 321-384 | ||||||
| CDS_position | 61-124 | ||||||
| Protein_position | 21-42 | ||||||
| Exon_number | 3/7 | ||||||
| Codon_change | TTTATCGCCAGCCGGCCAGTTATCCAGTTCGATCGGCGACCAGGATACGTTCCGACGCCGTGGAga/ga | ||||||
| Amino_acid_change | FIASRPVIQFDRRPGYVPTPWR/X | ||||||
| Description | Phenotype | WBPhenotype:0000742 | Paper_evidence | WBPaper00048558 | |||
| Curator_confirmed | WBPerson13228 | ||||||
| Remark | Figure 2: h2875 recombination abnormal phenotype (dpy-5 - unc-13 interval) is recessive and h2875 fails to complement s180. Supplemental Figure 2: h2875 recombination abnormal phenotype can be observed across Chromosome III in h2875 homozygotes. | Paper_evidence | WBPaper00048558 | ||||
| Curator_confirmed | WBPerson13228 | ||||||
| Recessive | Paper_evidence | WBPaper00048558 | |||||
| Curator_confirmed | WBPerson13228 | ||||||
| Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00048558 | ||||
| Curator_confirmed | WBPerson13228 | ||||||
| Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00048558 | ||||
| Curator_confirmed | WBPerson13228 | ||||||
| Remark | Figure 5A: no significant difference in embryonic lethality between WT and h2875 homozygotes. | Paper_evidence | WBPaper00048558 | ||||
| Curator_confirmed | WBPerson13228 | ||||||
| Recessive | Paper_evidence | WBPaper00048558 | |||||
| Curator_confirmed | WBPerson13228 | ||||||
| Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00048558 | ||||
| Curator_confirmed | WBPerson13228 | ||||||
| Reference | WBPaper00048558 | ||||||
| Method | Engineered_allele |
