WormBase Tree Display for Variation: WBVar02145224

WBVar02145224 Name: Public_name: tm8061
    Other_name: D1086.17.1:c.107+59_107+151del
    HGVSg: CHROMOSOME_V:g.14068869_14068961del
  Sequence_details: SMap: S_parent: Sequence: D1086
    Flanking_sequences: aaaaattcgcagtgacttcaaataaaaggg actatataaatattattaaaaccagaataa
    Mapping_target: D1086
    Source_location: 7 CHROMOSOME_V 14068868 14068962 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm8061_external
      tm8061_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 8061
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00045355
    Transcript: D1086.17.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: D1086.17.1:c.107+59_107+151del
        Intron_number: 3/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 5408/5409-5501/5502 (93 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele