WormBase Tree Display for Variation: WBVar02146400
expand all nodes | collapse all nodes | view schema
| WBVar02146400 | Evidence | Paper_evidence | WBPaper00049389 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | yad21 | |||||||
| Other_name | CE31847:p.Pro4813Ser | ||||||||
| B0350.2f.1:c.14437C>T | |||||||||
| HGVSg | CHROMOSOME_IV:g.5997110C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | B0350 | |||||
| Flanking_sequences | gttgaatcggaaaggtatgcgtcaggatca | cagttccatcagaagaagactcgagccgcg | |||||||
| Mapping_target | B0350 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00049389 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | NYL | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006780 | |||||||
| Transcript | B0350.2f.1 | VEP_consequence | missense_variant | ||||||
| VEP_impact | MODERATE | ||||||||
| HGVSc | B0350.2f.1:c.14437C>T | ||||||||
| HGVSp | CE31847:p.Pro4813Ser | ||||||||
| cDNA_position | 14437 | ||||||||
| CDS_position | 14437 | ||||||||
| Protein_position | 4813 | ||||||||
| Exon_number | 16/20 | ||||||||
| Codon_change | Cca/Tca | ||||||||
| Amino_acid_change | P/S | ||||||||
| Interactor | WBInteraction000535492 | ||||||||
| WBInteraction000535494 | |||||||||
| WBInteraction000535496 | |||||||||
| WBInteraction000535499 | |||||||||
| Genetics | Interpolated_map_position | IV | 2.88771 | ||||||
| Description | Phenotype | WBPhenotype:0002521 | Paper_evidence | WBPaper00049389 | |||||
| Curator_confirmed | WBPerson30255 | ||||||||
| EQ_annotations | GO_term | GO:0005921 | PATO:0000470 | Paper_evidence | WBPaper00049389 | ||||
| Curator_confirmed | WBPerson30255 | ||||||||
| Reference | WBPaper00049389 | ||||||||
| Remark | In addition to the lesion curated, yad21 also introduces a Q6827Ochre premature stop codon with flanking sequences of gagccaacgttccaagaaattgaagttgag aacgtccagaaagtgttgaagacacatcac | Paper_evidence | WBPaper00049389 | ||||||
| Method | Substitution_allele |
