WormBase Tree Display for Variation: WBVar02146625

WBVar02146625 Evidence: Paper_evidence: WBPaper00049977
  Name: Public_name: mg502
    Other_name: K05C4.2.2:c.-16-255_-16-134delinsTGGATA
    HGVSg: CHROMOSOME_I:g.14721489_14721610delinsTATCCA
  Sequence_details: SMap: S_parent: Sequence: K05C4
    Flanking_sequences: attgcgaaaaccgcgcgcgcgcattgcaaa actgatgaatgtgtagagttggtcgatatt
    Mapping_target: K05C4
    Type_of_mutation: Insertion: TGGATA
      Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: GR
    Status: Live
  Affects: Gene: WBGene00010579
    Transcript: K05C4.2.2 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: K05C4.2.2:c.-16-255_-16-134delinsTGGATA
        Intron_number: 1/4
  Genetics: Interpolated_map_position: I 26.4741
  Description: Phenotype: WBPhenotype:0001236 Paper_evidence: WBPaper00049977
        Curator_confirmed: WBPerson5649
        Remark: expression of mgIs72[rpt-3::gfp] transgene increased Paper_evidence: WBPaper00049977
            Curator_confirmed: WBPerson5649
        Recessive: Paper_evidence: WBPaper00049977
          Curator_confirmed: WBPerson5649
        Phenotype_assay: Control_strain: WBStrain00007961 Paper_evidence: WBPaper00049977
              Curator_confirmed: WBPerson5649
          Genotype: mgIs72[rpt-3::gfp] Paper_evidence: WBPaper00049977
              Curator_confirmed: WBPerson5649
    Phenotype_not_observed: WBPhenotype:0000688 Paper_evidence: WBPaper00056554
        Curator_confirmed: WBPerson5649
        Remark: Not sterile (no sterile animals at 20°C or 25°C) Paper_evidence: WBPaper00056554
            Curator_confirmed: WBPerson5649
  Reference: WBPaper00049977
    WBPaper00056554
  Remark: This deletion probably affects the expression of both K05C4.2 and pbs-5. The phenotype is probably entirely due to reduced pbs-5 expression Paper_evidence: WBPaper00049977
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003951 Regulatory_feature Paper_evidence: WBPaper00049977
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003951 Genomic_neighbourhood
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00010579
  Method: Deletion_and_insertion_allele