WormBase Tree Display for Variation: WBVar02146626
expand all nodes | collapse all nodes | view schema
WBVar02146626 | Evidence | Paper_evidence | WBPaper00049977 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mg570 | ||||||
Other_name | T19E7.2a.1:c.4_9delinsTAATGA | |||||||
CE27591:p.Gly2_Gly3delinsTer | ||||||||
HGVSg | CHROMOSOME_IV:g.5660376_5660381delinsTCATTA | |||||||
Sequence_details | SMap | S_parent | Sequence | T19E7 | ||||
Flanking_sequences | caggatctatcataatccagtcagtcgatg | tcatcacgccgtcagcgaagtacgtcggcg | ||||||
Mapping_target | T19E7 | |||||||
Type_of_mutation | Insertion | TAATGA | ||||||
Deletion | GGCGGT | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Engineered_allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00007966 | |||||||
Laboratory | GR | |||||||
Production_method | CRISPR_Cas9 | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004804 | ||||||
Transcript | T19E7.2a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | T19E7.2a.1:c.4_9delinsTAATGA | |||||||
HGVSp | CE27591:p.Gly2_Gly3delinsTer | |||||||
cDNA_position | 4-10 | |||||||
CDS_position | 4-10 | |||||||
Protein_position | 2-4 | |||||||
Exon_number | 1/9 | |||||||
Codon_change | GGCGGTTca/TAATGATca | |||||||
Amino_acid_change | GGS/**S | |||||||
Description | Phenotype | WBPhenotype:0000038 | Paper_evidence | WBPaper00056554 | ||||
Curator_confirmed | WBPerson5649 | |||||||
Remark | Age-associated vulval integrity defect | Paper_evidence | WBPaper00056554 | |||||
Curator_confirmed | WBPerson5649 | |||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00061439 | ||||||
Curator_confirmed | WBPerson49407 | |||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00053771 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | There is an increase in gst-4mRNA levels in skn-1(mg570) mutants. | Paper_evidence | WBPaper00053771 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00061439 | ||||||
Curator_confirmed | WBPerson49407 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00056554 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
Remark | reduced lifespan | Paper_evidence | WBPaper00056554 | |||||
Curator_confirmed | WBPerson5649 | |||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
Remark | increased expression of mgIs77[rpl-28::ub(G76V)::GFP]; Failure to completely degrade ub(G76V)::GFP | Paper_evidence | WBPaper00057217 | |||||
Curator_confirmed | WBPerson5649 | |||||||
Phenotype_assay | Control_strain | WBStrain00007977 | Paper_evidence | WBPaper00057217 | ||||
Curator_confirmed | WBPerson5649 | |||||||
Genotype | mgIs77 [rpl-28::ub(G76V)::GFP] | Paper_evidence | WBPaper00057217 | |||||
Curator_confirmed | WBPerson5649 | |||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00049977 | ||||||
WBPaper00056554 | ||||||||
WBPaper00057217 | ||||||||
Curator_confirmed | WBPerson5649 | |||||||
Remark | expression of mgIs72[rpt-3::gfp] transgene reduced; Figure 2c | Paper_evidence | WBPaper00049977 | |||||
Curator_confirmed | WBPerson5649 | |||||||
expression of mgIs72[rpt-3::gfp] transgene reduced. rpt-3::gfp expression is not induced in body wall of unc-54(mg519); skn-1(mg570) double mutants | Paper_evidence | WBPaper00056554 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
expression of mgIs72[rpt-3::gfp] transgene reduced. rpt-3::gfp expression is not induced in body wall of unc-54(e1301); skn-1(mg570) double mutants | Paper_evidence | WBPaper00056554 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
expression of mgIs72[rpt-3::gfp] transgene is not induced by amyloid beta (1-42) peptide | Paper_evidence | WBPaper00056554 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
induction of dvIs19[gst-4::gfp] by bortezomib reduced (Figure S6A) | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
reduced expression of mgIs72[rpt-3::gfp]; Basal expression of rpt-3::gfp reduced under standard culture conditions | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
Recessive | Paper_evidence | WBPaper00049977 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
Affected_by | Molecule | WBMol:00003099 | Paper_evidence | WBPaper00057217 | ||||
Curator_confirmed | WBPerson5649 | |||||||
Phenotype_assay | Control_strain | WBStrain00043199 | Paper_evidence | WBPaper00049977 | ||||
Curator_confirmed | WBPerson5649 | |||||||
WBStrain00043205 | Paper_evidence | WBPaper00056554 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
WBStrain00005102 | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
WBStrain00007961 | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
Genotype | pbs-5(mg502); mgIs72[rpt-3::gfp] | Paper_evidence | WBPaper00049977 | |||||
Curator_confirmed | WBPerson5649 | |||||||
mgIs72[rpt-3::gfp]; unc-54(mg519) | Paper_evidence | WBPaper00056554 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
mgIs72[rpt-3::gfp]; unc-54(e1301) | Paper_evidence | WBPaper00056554 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
mgIs72 [rpt-3::gfp] II; dvIs2 [Punc-54::human Beta-peptide 1-42 minigene+ pRF4] | Paper_evidence | WBPaper00056554 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
dvIs19 [gst-4::gfp] | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
mgIs72 [rpt-3::gfp] | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
WBPhenotype:0001405 | Paper_evidence | WBPaper00056554 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
Remark | Accumulation of Amyloid beta peptide increased. Increased accumulation of GFP::Abeta in day 2 adults compared to wild type | Paper_evidence | WBPaper00056554 | |||||
Curator_confirmed | WBPerson5649 | |||||||
Phenotype_assay | Control_strain | WBStrain00005104 | Paper_evidence | WBPaper00056554 | ||||
Curator_confirmed | WBPerson5649 | |||||||
Genotype | dvIs37 [myo-3p::GFP::A-Beta (3-42) + rol-6(su1006)] | Paper_evidence | WBPaper00056554 | |||||
Curator_confirmed | WBPerson5649 | |||||||
WBPhenotype:0001918 | Paper_evidence | WBPaper00049977 | ||||||
WBPaper00057217 | ||||||||
Curator_confirmed | WBPerson5649 | |||||||
Remark | increased sensitivity to bortezomib; Figure 2h, bortezomib concentration that causes developmental arrest is ~100x lower than wild type | Paper_evidence | WBPaper00049977 | |||||
Curator_confirmed | WBPerson5649 | |||||||
Increased sensitivity to bortezomib; Complete developmental arrest/larval lethality on plates containing 0.4 μg/ml bortezomib | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
Increased sensitivity to bortezomib; >90% of adult animals die within 4 days on plates containing 0.04 μg/ml bortezomib | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
Affected_by | Molecule | WBMol:00003099 | Paper_evidence | WBPaper00049977 | ||||
WBPaper00057217 | ||||||||
Curator_confirmed | WBPerson5649 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00049977 | ||||
WBPaper00057217 | ||||||||
Curator_confirmed | WBPerson5649 | |||||||
Genotype | wild type | Paper_evidence | WBPaper00057217 | |||||
Curator_confirmed | WBPerson5649 | |||||||
WBPhenotype:0001937 | Paper_evidence | WBPaper00056554 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
Remark | Human amyloid beta (1-42) peptide toxicity enanced. Increased proportion of dvIs2 transgenic adults paralyzed | Paper_evidence | WBPaper00056554 | |||||
Curator_confirmed | WBPerson5649 | |||||||
Phenotype_assay | Control_strain | WBStrain00005094 | Paper_evidence | WBPaper00056554 | ||||
Curator_confirmed | WBPerson5649 | |||||||
Genotype | dvIs2 [Punc-54::human Beta-peptide 1-42 minigene+ pRF4] | Paper_evidence | WBPaper00056554 | |||||
Curator_confirmed | WBPerson5649 | |||||||
Phenotype_not_observed | WBPhenotype:0001278 | Paper_evidence | WBPaper00057217 | |||||
Curator_confirmed | WBPerson5649 | |||||||
Remark | induction of gst-4::gfp by juglone is not lost in mg570 mutants | Paper_evidence | WBPaper00057217 | |||||
Curator_confirmed | WBPerson5649 | |||||||
induction of gst-4::gfp by tkt-1(RNAi) is not lost in mg570 mutants | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
induction of gst-4::gfp by wdr-23(RNAi) is not lost in mg570 mutants | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
Affected_by | Molecule | WBMol:00004938 | Paper_evidence | WBPaper00057217 | ||||
Curator_confirmed | WBPerson5649 | |||||||
Phenotype_assay | Control_strain | WBStrain00005102 | Paper_evidence | WBPaper00057217 | ||||
Curator_confirmed | WBPerson5649 | |||||||
Genotype | dvIs19 [gst-4::gfp] | Paper_evidence | WBPaper00057217 | |||||
Curator_confirmed | WBPerson5649 | |||||||
dvIs19 [gst-4::gfp]; tkt-1(RNAi) | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
dvIs19 [gst-4::gfp]; wdr-23(RNAi) | Paper_evidence | WBPaper00057217 | ||||||
Curator_confirmed | WBPerson5649 | |||||||
Disease_info | Modifies_disease | DOID:10652 | ||||||
Modifies_disease_in_annotation | WBDOannot00000729 | |||||||
WBDOannot00000731 | ||||||||
Reference | WBPaper00049977 | |||||||
WBPaper00056554 | ||||||||
WBPaper00057217 | ||||||||
WBPaper00053771 | ||||||||
WBPaper00061439 | ||||||||
Remark | This crispr allele actually introduces a double stop mutation G(2) to Ochre Stop and G(3) to Opal Stop | Person_evidence | WBPerson5649 | |||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00004804 Ochre_UAA G(2) to Stop | Person_evidence | WBPerson5649 | ||||||
Method | Engineered_allele |