WormBase Tree Display for Variation: WBVar02147345
expand all nodes | collapse all nodes | view schema
WBVar02147345 | Evidence | Paper_evidence | WBPaper00050412 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | uth2 | |||||||
Other_name | CE46695:p.Glu367Lys | ||||||||
CE39067:p.Glu367Lys | |||||||||
Y71G12B.9b.1:c.1099G>A | |||||||||
Y71G12B.9a.1:c.1099G>A | |||||||||
HGVSg | CHROMOSOME_I:g.1762335G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y71G12B | |||||
Flanking_sequences | gtgtccgcactgacagaagagctgaaaaag | agaagctggctcacgcgggaacccgttcag | |||||||
Mapping_target | Y71G12B | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00050412 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | AGD | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00022149 | |||||||
Transcript | Y71G12B.9b.1 (12) | ||||||||
Y71G12B.9a.1 (12) | |||||||||
Interactor | WBInteraction000537568 | ||||||||
WBInteraction000537569 | |||||||||
Genetics | Interpolated_map_position | I | -12.9088 | ||||||
Description | Phenotype | WBPhenotype:0001278 | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We isolated 16 mutant strains that exhibited a partial or complete suppression of PolyQ-dependent hsp-6p::gfp expression in the F2 generation. The strong and stable suppression of the reporter GFP expression in a strain carrying the uth2 mutation caused us to prioritize it for additional characterization (Figure S1A)." | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | zcs13 [hsp-6p::GFP]; rmIs101 [rgef-1p::Q40::YFP] | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00050412 | ||||||||
Method | Substitution_allele |