WormBase Tree Display for Variation: WBVar02149351
expand all nodes | collapse all nodes | view schema
| WBVar02149351 | Name | Public_name | m209 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | CE09197:p.Glu835Lys | ||||||
| F07A5.7b.1:c.1546G>A | |||||||
| F07A5.7a.2:c.2503G>A | |||||||
| CE42754:p.Glu516Lys | |||||||
| F07A5.7a.1:c.2503G>A | |||||||
| HGVSg | CHROMOSOME_I:g.7377685C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F07A5 | |||
| Flanking_sequences | cgcagataccaacacgagctcgaggatgct | agggccgtgccgatcaagccgagtccagcc | |||||
| Mapping_target | F07A5 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001431 | ||
| Person_evidence | WBPerson267 | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00006281 | ||||||
| Laboratory | DR | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006754 | |||||
| Transcript | F07A5.7a.1 (12) | ||||||
| F07A5.7a.2 (12) | |||||||
| F07A5.7b.1 (12) | |||||||
| Isolation | Mutagen | EMS | |||||
| Forward_genetics | standard phenotypic screen | ||||||
| Genetics | Interpolated_map_position | I | 2.05437 | ||||
| Reference | WBPaper00001431 | ||||||
| Remark | The m208, m209 and m193 mutations were reported in Brown and Riddle 1985 PMID: 4018568 | ||||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Missense 834 E to K | Paper_evidence | WBPaper00001431 | |||||
| Method | Substitution_allele |
