WormBase Tree Display for Variation: WBVar02149352

WBVar02149352 Name: Public_name: m208
    Other_name: CE42754:p.Arg507Lys
      F07A5.7a.1:c.2477G>A
      F07A5.7b.1:c.1520G>A
      F07A5.7a.2:c.2477G>A
      CE09197:p.Arg826Lys
    HGVSg: CHROMOSOME_I:g.7377711C>T
  Sequence_details: SMap: S_parent: Sequence: F07A5
    Flanking_sequences: taacaatgcaaaacctccagagagtccgca ataccaacacgagctcgaggatgctgaggg
    Mapping_target: F07A5
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00001431
            Person_evidence: WBPerson267
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00006280
    Laboratory: DR
    Status: Live
  Affects: Gene: WBGene00006754
    Transcript: F07A5.7a.1 (12)
      F07A5.7a.2 (12)
      F07A5.7b.1 (12)
  Isolation: Mutagen: EMS
    Forward_genetics: standard phenotypic screen
  Genetics: Interpolated_map_position: I 2.05439
  Reference: WBPaper00001431
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Missense 826 R to K Paper_evidence: WBPaper00001431
  Method: Substitution_allele