WormBase Tree Display for Variation: WBVar02149957
expand all nodes | collapse all nodes | view schema
| WBVar02149957 | Evidence | Paper_evidence | WBPaper00053268 | ||
|---|---|---|---|---|---|
| Name | Public_name | hu97 | |||
| Other_name | F47A4.2.1:c.3607C>A | ||||
| CE16058:p.Glu1203Lys | |||||
| HGVSg | CHROMOSOME_X:g.9817987G>T | ||||
| Sequence_details | SMap | S_parent | Sequence | F47A4 | |
| Flanking_sequences | ctagacgatcttttgagacaattccgagca | aaacctatcatgaccaacatctgattttgg | |||
| Mapping_target | F47A4 | ||||
| Type_of_mutation | Substitution | g | a | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | KN | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00001081 | |||
| Transcript | F47A4.2.1 (12) | ||||
| Genetics | Interpolated_map_position | X | 1.71155 | ||
| Remark | Premature stop exon 9: Q1203Stop (LGX: 9,817,929 G . A), tgataggtttGtgctcggaat | ||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001081 Ochre_UAA Q(1203) to stop | Paper_evidence | WBPaper00053268 | |||
| Method | Substitution_allele |
