WormBase Tree Display for Variation: WBVar02152226
expand all nodes | collapse all nodes | view schema
WBVar02152226 | Name | Public_name | tm11927 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | B0496.3g.1:c.2773+108_2774-125del | |||||||
B0496.3f.1:c.2803_2890+9del | ||||||||
B0496.3i.1:c.2854_2941+9del | ||||||||
B0496.3d.1:c.2803_2890+9del | ||||||||
B0496.3b.1:c.2803_2890+9del | ||||||||
B0496.3h.1:c.2773+108_2774-125del | ||||||||
B0496.3a.2:c.2680_2767+9del | ||||||||
B0496.3a.1:c.2680_2767+9del | ||||||||
B0496.3h.2:c.2773+108_2774-125del | ||||||||
B0496.3e.1:c.3520_3607+9del | ||||||||
HGVSg | CHROMOSOME_IV:g.7437967_7438063del | |||||||
Sequence_details | SMap | S_parent | Sequence | B0496 | ||||
Flanking_sequences | gctgtggtgccagtgattcatcaaactact | tcttgctattcaaaacccaattctcaccaa | ||||||
Mapping_target | B0496 | |||||||
Source_location | 7 | CHROMOSOME_IV | 7437966 | 7438064 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm11927_external | |||||||
tm11927_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 11927 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006814 | ||||||
Transcript | B0496.3h.2 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | B0496.3h.2:c.2773+108_2774-125del | |||||||
Intron_number | 13/27 | |||||||
B0496.3a.2 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0496.3a.2:c.2680_2767+9del | |||||||
cDNA_position | 2694-? | |||||||
CDS_position | 2680-? | |||||||
Protein_position | 894-? | |||||||
Intron_number | 14/27 | |||||||
Exon_number | 14/28 | |||||||
B0496.3b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0496.3b.1:c.2803_2890+9del | |||||||
cDNA_position | 2803-? | |||||||
CDS_position | 2803-? | |||||||
Protein_position | 935-? | |||||||
Intron_number | 14/30 | |||||||
Exon_number | 14/31 | |||||||
B0496.3i.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0496.3i.1:c.2854_2941+9del | |||||||
cDNA_position | 2854-? | |||||||
CDS_position | 2854-? | |||||||
Protein_position | 952-? | |||||||
Intron_number | 14/29 | |||||||
Exon_number | 14/30 | |||||||
B0496.3g.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | B0496.3g.1:c.2773+108_2774-125del | |||||||
Intron_number | 16/31 | |||||||
B0496.3a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0496.3a.1:c.2680_2767+9del | |||||||
cDNA_position | 3149-? | |||||||
CDS_position | 2680-? | |||||||
Protein_position | 894-? | |||||||
Intron_number | 19/32 | |||||||
Exon_number | 19/33 | |||||||
B0496.3e.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0496.3e.1:c.3520_3607+9del | |||||||
cDNA_position | 3522-? | |||||||
CDS_position | 3520-? | |||||||
Protein_position | 1174-? | |||||||
Intron_number | 20/34 | |||||||
Exon_number | 20/35 | |||||||
B0496.3f.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0496.3f.1:c.2803_2890+9del | |||||||
cDNA_position | 2803-? | |||||||
CDS_position | 2803-? | |||||||
Protein_position | 935-? | |||||||
Intron_number | 14/28 | |||||||
Exon_number | 14/29 | |||||||
B0496.3h.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | B0496.3h.1:c.2773+108_2774-125del | |||||||
Intron_number | 16/30 | |||||||
B0496.3d.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0496.3d.1:c.2803_2890+9del | |||||||
cDNA_position | 2908-? | |||||||
CDS_position | 2803-? | |||||||
Protein_position | 935-? | |||||||
Intron_number | 17/32 | |||||||
Exon_number | 17/33 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Remark | 21520/21521-21617/21618(97 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |