WormBase Tree Display for Variation: WBVar02152742

WBVar02152742 Name: Public_name: tm12501
    HGVSg: CHROMOSOME_III:g.6518345_6519405del
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_III
    Flanking_sequences: acacttgtctttcatgacacagtttttgct tttctttcaaggttataaatgttgatgggt
    Mapping_target: CHROMOSOME_III
    Source_location: 7 CHROMOSOME_III 6518344 6519406 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm12501_external
      tm12501_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 12501
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00044295
    Transcript: C09E7.10.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: 294-?
        CDS_position: 272-?
        Protein_position: 91-?
        Intron_number: 3-4/5
        Exon_number: 3-6/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Remark: [K03F8]8190/8191-[C09E7]951/952(1061 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target K03F8 updated based on the VEP analysis pipeline to CHROMOSOME_III.
  Method: NBP_knockout_allele