WormBase Tree Display for Variation: WBVar02152815
expand all nodes | collapse all nodes | view schema
| WBVar02152815 | Name | Public_name | xn84 | |
|---|---|---|---|---|
| Sequence_details | SeqStatus | Pending_curation | ||
| Variation_type | Engineered_allele | |||
| Origin | Species | Caenorhabditis elegans | ||
| Laboratory | FT | |||
| Production_method | CRISPR_Cas9 | |||
| Status | Live | |||
| Possibly_affects | WBGene00001072 | Paper_evidence | WBPaper00059266 | |
| Remark | CGC_name dpy-10 | |||
| WBGene00004034 | Paper_evidence | WBPaper00059266 | ||
| Remark | CGC_name pkc-3 | |||
| Reference | WBPaper00059266 | |||
| Remark | [2020-02-08T03:10:05.122Z WBPerson712] New Variation: WBPaper00059266 pkc-3(it309[gfp::pkc-3]) worms were injected using a crRNA with target homology sequence 5-CCGGTAGAAAAAATGAGTAA-3 and a repair ssDNA oligo containing sequences encoding the ZF1 domain and GGGCCC linker: 5-AGTTCAATTTTTATTTCAGAGTACCGGTAGAAAAAATGACAGAATACAAAACGCGACTTTGTGATGCGTTCCGCCGTGAAGGATACTGCCCGTACAACGACAATTGCACATATGCTCACGGACAAGATGAGCTGAGAGTTCCGAGGGTAGGGCCCATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCC-3. pkc-3(xn84[zf1::gfp::pkc-3]) was outcrossed to N2 to remove a linked dpy-10(cn64) mutation that was introduced by co-CRISPR during genome editing | Curator_confirmed | WBPerson712 | |
| Method | Engineered_allele |
