WormBase Tree Display for Variation: WBVar02153226
expand all nodes | collapse all nodes | view schema
| WBVar02153226 | Evidence | Person_evidence | WBPerson41981 | ||
|---|---|---|---|---|---|
| Name | Public_name | cer22 | |||
| Other_name | CE00122:p.Arg2303Gly | ||||
| C50C3.6.1:c.6885_6909delinsAGAGTATTACCACGAAGATCACGGC | |||||
| HGVSg | CHROMOSOME_III:g.8172146_8172170delinsAGAGTATTACCACGAAGATCACGGC | ||||
| Sequence_details | SMap | S_parent | Sequence | C50C3 | |
| Flanking_sequences | gaagttcgatgtgtgtctttctaatccaaa | ccggttcacttccataactttaaggtattc | |||
| Mapping_target | C50C3 | ||||
| Type_of_mutation | Insertion | AGAGTATTACCACGAAGATCACGGC | |||
| Deletion | GGAGTACTATCATGAAGATCATCGG | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Engineered_allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00048023 | ||||
| Component_of_genotype | WBGenotype00000120 | ||||
| Laboratory | CER | ||||
| Person | WBPerson41981 | ||||
| Production_method | CRISPR_Cas9 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00004187 | |||
| Transcript | C50C3.6.1 | VEP_consequence | missense_variant | ||
| VEP_impact | MODERATE | ||||
| HGVSc | C50C3.6.1:c.6885_6909delinsAGAGTATTACCACGAAGATCACGGC | ||||
| HGVSp | CE00122:p.Arg2303Gly | ||||
| cDNA_position | 6888-6913 | ||||
| CDS_position | 6884-6909 | ||||
| Protein_position | 2295-2303 | ||||
| Exon_number | 10/12 | ||||
| Codon_change | aAGGAGTACTATCATGAAGATCATCGG/aAAGAGTATTACCACGAAGATCACGGC | ||||
| Amino_acid_change | KEYYHEDHR/KEYYHEDHG | ||||
| Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00059062 | |
| Curator_confirmed | WBPerson41981 | ||||
| Disease_info | Models_disease | DOID:0110403 | |||
| Models_disease_in_annotation | WBDOannot00001206 | ||||
| WBDOannot00001210 | |||||
| WBDOannot00001211 | |||||
| WBDOannot00001212 | |||||
| Reference | WBPaper00059062 | ||||
| Remark | G GAG TAC TAT CAT GAA GAT CAT CGG substituted for A GAG TAT TAC CAC GAA GAT CAC GGC (spaces denote codons). This results in R2303G missense mutation and 5 synonymous mutations. | ||||
| Details provided: alt_det = Complex sequence one missense mutations with several synonymous mutations mut_det = R2303G | |||||
| Method | Engineered_allele |
