WormBase Tree Display for Variation: WBVar02153230
expand all nodes | collapse all nodes | view schema
WBVar02153230 | Evidence | Person_evidence | WBPerson41981 | ||
---|---|---|---|---|---|
Name | Public_name | cer119 | |||
Sequence_details | SMap | S_parent | Sequence | Y87G2A | |
Flanking_sequences | tatcgcgacaaaaaccgattttataatcac | ggacacctgaaattctggaaaaagaagcat | |||
Mapping_target | Y87G2A | ||||
SeqStatus | Sequenced | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00048028 | ||||
Laboratory | CER | ||||
Person | WBPerson41981 | ||||
Status | Live | ||||
Affects | Gene | WBGene00000891 | |||
Transcript | Y87G2A.6.1 | ||||
Description | Phenotype_not_observed | WBPhenotype:0000031 | Paper_evidence | WBPaper00059062 | |
Curator_confirmed | WBPerson41981 | ||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00059062 | |||
Curator_confirmed | WBPerson41981 | ||||
Reference | WBPaper00059062 | ||||
Remark | T GCA AGC GTC GAT substitution for A GCG TCT GTG CAA (spaces denote codons). It results in 4 synonymous mutations and one missense D74Q.</td> | ||||
Details provided: alt_det = Complex sequence one missense mutations with several synonymous mutations mut_det = D74Q | |||||
Method | Allele |