WormBase Tree Display for Variation: WBVar02153378
expand all nodes | collapse all nodes | view schema
| WBVar02153378 | Evidence | Person_evidence | WBPerson8908 | ||
|---|---|---|---|---|---|
| Name | Public_name | ulv12 | |||
| Other_name | F27D9.1a.1:c.104_110del | ||||
| CE24927:p.Leu36CysfsTer24 | |||||
| HGVSg | CHROMOSOME_X:g.7683099_7683105del | ||||
| Sequence_details | SMap | S_parent | Sequence | F27D9 | |
| Flanking_sequences | gtagcgcgtggaatgttctcatcgttgaca | catgcggatgttgtcatcctgctgcaaaat | |||
| Mapping_target | F27D9 | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00048381 | ||||
| Component_of_genotype | WBGenotype00000054 | ||||
| WBGenotype00000055 | |||||
| WBGenotype00000056 | |||||
| WBGenotype00000057 | |||||
| WBGenotype00000058 | |||||
| WBGenotype00000059 | |||||
| WBGenotype00000060 | |||||
| WBGenotype00000061 | |||||
| WBGenotype00000062 | |||||
| Laboratory | AMG | ||||
| Person | WBPerson8908 | ||||
| Production_method | CRISPR_Cas9 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00006757 | |||
| Transcript | F27D9.1a.1 | VEP_consequence | frameshift_variant | ||
| VEP_impact | HIGH | ||||
| HGVSc | F27D9.1a.1:c.104_110del | ||||
| HGVSp | CE24927:p.Leu36CysfsTer24 | ||||
| cDNA_position | 140-146 | ||||
| CDS_position | 104-110 | ||||
| Protein_position | 35-37 | ||||
| Exon_number | 3/11 | ||||
| Codon_change | aCCCTAGCc/ac | ||||
| Amino_acid_change | TLA/X | ||||
| Description | Phenotype | WBPhenotype:0000019 | Paper_evidence | WBPaper00059359 | |
| Curator_confirmed | WBPerson8908 | ||||
| WBPhenotype:0000643 | Paper_evidence | WBPaper00059359 | |||
| Curator_confirmed | WBPerson8908 | ||||
| WBPhenotype:0000644 | Paper_evidence | WBPaper00059359 | |||
| Curator_confirmed | WBPerson8908 | ||||
| Disease_info | Models_disease | DOID:0112202 | |||
| Models_disease_in_annotation | WBDOannot00000973 | ||||
| Reference | WBPaper00059359 | ||||
| Remark | deletion of 7 bp results in a frameshift and premature stop codon | Paper_evidence | WBPaper00059359 | ||
| Person_evidence | WBPerson8908 | ||||
| Curator_confirmed | WBPerson51134 | ||||
| Variation information submitted by WBPerson8908 on 2021-05-24_04:54:56 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
| Variation stub generated from the April 2021 NN VFP dataset. | |||||
| Method | Engineered_allele |
