WormBase Tree Display for Variation: WBVar02153758
expand all nodes | collapse all nodes | view schema
WBVar02153758 | Name | Public_name | gk5537 | ||
---|---|---|---|---|---|
Other_name | Y54G2A.2b.1:c.373_1285del | ||||
CE37292:p.Gly125TrpfsTer16 | |||||
CE26776:p.Gly125TrpfsTer16 | |||||
Y54G2A.2a.1:c.373_1285del | |||||
HGVSg | CHROMOSOME_IV:g.2790557_2794717del | ||||
Sequence_details | SMap | S_parent | Sequence | Y54G2A | |
Flanking_sequences | AATTCTCCATTATCCGGATTCTCGTGGCGT | TGGAACGGTTGGAATCTGATTTGCAGGTAA | |||
Mapping_target | CHROMOSOME_IV | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00047686 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects (2) | |||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Genetics | Interpolated_map_position | IV | -6.7398 | ||
Remark | Batch created from Strain genotype data | Curator_confirmed | WBPerson1983 | ||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is imperfect, but it was not sequenced. | |||||
Method | Deletion_allele |