WormBase Tree Display for Variation: WBVar02156764
expand all nodes | collapse all nodes | view schema
| WBVar02156764 | Name | Public_name | gk5938 | ||
|---|---|---|---|---|---|
| Other_name | CE37012:p.Arg24TrpfsTer33 | ||||
| F43C1.3.1:c.70_545del | |||||
| HGVSg | CHROMOSOME_III:g.4243796_4244316del | ||||
| Sequence_details | SMap | S_parent | Sequence | Y44F5A | |
| Flanking_sequences | AACGAAATTCAACATTTCTTCGATGATCCA | TGGGCACTTGTATGGTTCTCGTTTTTCGAC | |||
| Mapping_target | CHROMOSOME_III | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Pending_curation | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00052121 | ||||
| Laboratory | VC | ||||
| Person | WBPerson427 | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00009648 | |||
| Transcript | F43C1.3.1 (11) | ||||
| Isolation | Mutagen | CRISPR_Cas9 | |||
| Remark | Variation accession generated for Mark Edgley for a set of gk CRISPR alleles. | ||||
| Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced. | |||||
| Method | Allele |
