WormBase Tree Display for Variation: WBVar02156972
expand all nodes | collapse all nodes | view schema
WBVar02156972 | Evidence | Person_evidence | WBPerson9055 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | cbc1 | |||||||
Other_name | CE06340:p.Leu261His | ||||||||
T01G9.2b.1:c.924+3130A>T | |||||||||
T01G9.2a.1:c.933+3130A>T | |||||||||
T01G9.3.1:c.782T>A | |||||||||
HGVSg | CHROMOSOME_I:g.8282923T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T01G9 | |||||
Flanking_sequences | aagaactgagatctcttcctcaactttctgttc | cgacttgtctcacaattccattcaagaaat | |||||||
Mapping_target | T01G9 | ||||||||
Type_of_mutation | Substitution | t | a | ||||||
SeqStatus | Sequenced | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00049500 | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00011345 | |||||||
WBGene00011344 | |||||||||
Transcript | T01G9.2a.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | T01G9.2a.1:c.933+3130A>T | ||||||||
Intron_number | 10/13 | ||||||||
T01G9.2b.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | T01G9.2b.1:c.924+3130A>T | ||||||||
Intron_number | 10/13 | ||||||||
T01G9.3.1 (12) | |||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | standard phenotype screen | ||||||||
Genetics | Interpolated_map_position | I | 2.70476 | ||||||
Description | Phenotype | WBPhenotype:0002648 | Paper_evidence | WBPaper00060449 | |||||
Curator_confirmed | WBPerson14621 | ||||||||
Remark | IL2, PVD, and FLP branching affected | Paper_evidence | WBPaper00060449 | ||||||
Curator_confirmed | WBPerson14621 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005118 | PATO:0000460 | Paper_evidence | WBPaper00060449 | ||||
Curator_confirmed | WBPerson14621 | ||||||||
WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00060449 | ||||||
Curator_confirmed | WBPerson14621 | ||||||||
WBbt:0006828 | PATO:0000460 | Paper_evidence | WBPaper00060449 | ||||||
Curator_confirmed | WBPerson14621 | ||||||||
GO_term | GO:0044307 | PATO:0000460 | Paper_evidence | WBPaper00060449 | |||||
Curator_confirmed | WBPerson14621 | ||||||||
GO:0030425 | PATO:0000460 | Paper_evidence | WBPaper00060449 | ||||||
Curator_confirmed | WBPerson14621 | ||||||||
Reference | WBPaper00060448 | ||||||||
WBPaper00060449 | |||||||||
Remark | Batch Variation object requested via get_NS_ids.pl | ||||||||
alt_det = point t to a mut_det = L to H | Paper_evidence | WBPaper00060448 | |||||||
Person_evidence | WBPerson9055 | ||||||||
Curator_confirmed | WBPerson51134 | ||||||||
Variation information submitted by WBPerson9055 on 2021-09-30_05:58:11 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||||
Method | Substitution_allele |