WormBase Tree Display for Variation: WBVar02157252
expand all nodes | collapse all nodes | view schema
WBVar02157252 | Evidence | Person_evidence | WBPerson268 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | F49E10 | |||||
Flanking_sequences | cgtggtcttgaagacaatcgccatttctat | gaatcccaaaaagaccgcttattttacgac | |||||||
Mapping_target | F49E10 | ||||||||
Type_of_mutation | Substitution | C | T | ||||||
SeqStatus | Sequenced | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00051526 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006424 | |||||||
Transcript | F49E10.5a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F49E10.5a.1:c.79C>T | ||||||||
HGVSp | CE29966:p.Arg27Ter | ||||||||
cDNA_position | 128 | ||||||||
CDS_position | 79 | ||||||||
Protein_position | 27 | ||||||||
Exon_number | 2/15 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Possibly_affects | WBGene00006424 | Paper_evidence | WBPaper00062453 | ||||||
Remark | CGC_name ctbp-1 | ||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | phenotypic screen | ||||||||
Genetics | Interpolated_map_position | X | -4.17133 | ||||||
Description | Phenotype | WBPhenotype:0000717 | Paper_evidence | WBPaper00062453 | |||||
Curator_confirmed | WBPerson268 | ||||||||
Remark | ceh-28, acbp-6 misexpressed in AIAs; glr-2, sra-11 not expressed in AIAs | Paper_evidence | WBPaper00062453 | ||||||
Curator_confirmed | WBPerson268 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00062453 | |||||||
Curator_confirmed | WBPerson268 | ||||||||
Remark | AIAs | Paper_evidence | WBPaper00062453 | ||||||
Curator_confirmed | WBPerson268 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006812 | PATO:0000460 | Paper_evidence | WBPaper00062453 | ||||
Curator_confirmed | WBPerson268 | ||||||||
WBPhenotype:0001085 | Paper_evidence | WBPaper00062453 | |||||||
Curator_confirmed | WBPerson268 | ||||||||
Affected_by | Molecule | WBMol:00005086 | Paper_evidence | WBPaper00062453 | |||||
Curator_confirmed | WBPerson268 | ||||||||
Reference | WBPaper00062453 | ||||||||
Remark | [2022-03-22T00:59:10.254Z WBPerson2987] New Variation: WBPaper00062453; allele of ctbp-1; early nonsense mutation and one of many presumptive null alleles of the gene). | Curator_confirmed | WBPerson2987 | ||||||
alt_det = C to T mut_det = R(27)Opal | Person_evidence | WBPerson268 | |||||||
Curator_confirmed | WBPerson51134 | ||||||||
Variation information submitted by WBPerson268 on 2022-03-3_09:48:38 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||||
Method | Substitution_allele |