WormBase Tree Display for Variation: WBVar02157912
expand all nodes | collapse all nodes | view schema
| WBVar02157912 | Evidence | Person_evidence | WBPerson38015 | ||
|---|---|---|---|---|---|
| Name | Public_name | raj109 | |||
| Other_name | M01D7.7c.1:c.*72_*108del | ||||
| M01D7.7b.1:c.*72_*108del | |||||
| M01D7.7a.1:c.*72_*108del | |||||
| HGVSg | CHROMOSOME_I:g.1840960_1840996del | ||||
| Sequence_details | SMap | S_parent | Sequence | M01D7 | |
| Flanking_sequences | ccatctctctctctctctctctctcactgg | tttcttgtactccttctaatttttgttttt | |||
| Mapping_target | M01D7 | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Production_method | CRISPR_Cas9 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00001196 | |||
| Transcript | M01D7.7b.1 | VEP_consequence | 3_prime_UTR_variant | ||
| VEP_impact | MODIFIER | ||||
| HGVSc | M01D7.7b.1:c.*72_*108del | ||||
| cDNA_position | 2530-2566 | ||||
| Exon_number | 9/9 | ||||
| M01D7.7a.1 | VEP_consequence | 3_prime_UTR_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | M01D7.7a.1:c.*72_*108del | ||||
| cDNA_position | 1415-1451 | ||||
| Exon_number | 10/10 | ||||
| M01D7.7c.1 | VEP_consequence | 3_prime_UTR_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | M01D7.7c.1:c.*72_*108del | ||||
| cDNA_position | 411-447 | ||||
| Exon_number | 4/4 | ||||
| Possibly_affects | WBGene00001196 | Paper_evidence | WBPaper00061301 | ||
| Remark | CGC_name egl-30 | ||||
| Description | Phenotype | WBPhenotype:0000646 | Paper_evidence | WBPaper00061301 | |
| Curator_confirmed | WBPerson38015 | ||||
| Reference | WBPaper00061301 | ||||
| Remark | Variation information submitted by WBPerson38015 on 2022-06-28_10:37:47 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||
| [2022-09-29T19:56:31.783Z WBPerson2987] New Variation: WBPaper00061301; Table S3 allele of egl-30 | Curator_confirmed | WBPerson2987 | |||
| Method | Engineered_allele |
