WormBase Tree Display for Variation: WBVar02158570
expand all nodes | collapse all nodes | view schema
WBVar02158570 | Evidence | Person_evidence | WBPerson143 | ||
---|---|---|---|---|---|
Name | Public_name | hq485 | |||
Sequence_details | SMap | S_parent | Sequence | T27A10 | |
Flanking_sequences | tatggactacaaaatgataaatatatggat | ataggcaacgcaggcggttgggatcttgac | |||
Mapping_target | F59D8 | ||||
Type_of_mutation | Insertion | ||||
SeqStatus | Sequenced | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00052772 | ||||
Production_method | CRISPR_Cas9 | ||||
Status | Live | ||||
Affects | Gene | WBGene00006927 | |||
Transcript | F59D8.1.1 | ||||
Possibly_affects | WBGene00006927 | Paper_evidence | WBPaper00064564 | ||
Reference | WBPaper00064564 | ||||
Remark | alt_det = the mCherry sequence is inserted at the C terminal of vit-3 mut_det = knock-in | Person_evidence | WBPerson143 | ||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson143 on 2023-01-29_19:07:36 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
[2023-04-25T18:42:25.92Z WBPerson51134] New Variation: Variation information submitted by WBPerson143 on 2023-01-29_19:07:36 via the Allele submission form. Reference WBPaper00064564. Allele of WBGene00006927. | Curator_confirmed | WBPerson51134 | |||
Method | Engineered_allele |