WormBase Tree Display for Feature: WBsf047490
expand all nodes | collapse all nodes | view schema
| WBsf047490 | SMap | S_parent | Sequence | Y75B8A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | caatgagccacctgacccctctccagctcat | tcgacaacaccagcgactcggcggttcctag | |
| Mapping_target | Y75B8A | |||
| DNA_text | GTTGCCATAGTAAC | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | X-box | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00028949 | ||
| Associations | Associated_with_gene | WBGene00003892 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000052 | |||
| Bound_by_product_of | WBGene00000914 | |||
| Remark | Transcription factor binding site, 107 bp upstream of start codon, in the promoter. | |||
| Method | TF_binding_site |
