WormBase Tree Display for Feature: WBsf691204
expand all nodes | collapse all nodes | view schema
| WBsf691204 | SMap | S_parent | Sequence | F57C7 |
|---|---|---|---|---|
| Name | Public_name | MCP_0000033990 | ||
| Sequence_details | Flanking_sequences | cttcaggtgacgtcatgtacagacattggt | aaaaactaaaatgtgatagcagtgcatttt | |
| Mapping_target | F57C7 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Clustered region of TSS sites. Number of tags=15. Shape score=0.266667. Assignement type=unassigned. Mode position in cluster=22. | ||
| SO_term | SO:0001240 | |||
| Defined_by | Defined_by_paper | WBPaper00042246 | ||
| Score | 15 | |||
| Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
| Method | TSS_region |
