WormBase Tree Display for Feature: WBsf919647
expand all nodes | collapse all nodes | view schema
| WBsf919647 | SMap | S_parent | Sequence | Y22F5A |
|---|---|---|---|---|
| Name | Public_name | I2h regulatory region | ||
| Sequence_details | Flanking_sequences | agctttttcttccacacttttccatatctt | ccatttacgtattgcattctgtccctccac | |
| Mapping_target | Y22F5A | |||
| DNA_text | tcttctcatttcgaatgcatgtcccttttt | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | I2h regulatory region within the first intron of snap-25, bound by unc-86:mec-3 heterodimer | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00006136 | ||
| Associations | Associated_with_gene | WBGene00004364 | ||
| Associated_with_Interaction | WBInteraction000521691 | |||
| Associated_with_transcription_factor | WBTranscriptionFactor000756 | |||
| Bound_by_product_of | WBGene00006814 | |||
| WBGene00003167 | ||||
| Method | TF_binding_site |
