WormBase Tree Display for Feature: WBsf976630
expand all nodes | collapse all nodes | view schema
| WBsf976630 | SMap | S_parent | Sequence | F33H2 | |
|---|---|---|---|---|---|
| Name | Public_name | GLD-1 binding site | |||
| Sequence_details | Flanking_sequences | ggtaactactttttactgtaacatatatct | tttccaatgaattcattttcagctatttat | ||
| Mapping_target | F33H2 | ||||
| DNA_text | TACTCAT | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | GLD-1 binding site on mRNA transcript of this gene. | |||
| SO_term | SO:0000409 | ||||
| Defined_by | Defined_by_paper | WBPaper00040521 | Curator_confirmed | WBPerson4025 | |
| Associations | Associated_with_gene | WBGene00009368 | |||
| Bound_by_product_of | WBGene00001595 | ||||
| Remark | Added this GLD-1 binding site as a 'binding_site'. It might be better to change this in future to 'translation_regulatory_region' or 'nucleotide_to_protein_binding_site'. | Curator_confirmed | WBPerson4025 | ||
| Method | binding_site |
