WormBase Tree Display for RNAi: WBRNAi00077429
expand all nodes | collapse all nodes | view schema
| WBRNAi00077429 | Homol | Homol_homol | F54C9:RNAi | ||
|---|---|---|---|---|---|
| B0273:RNAi | |||||
| F18A11:RNAi | |||||
| Y48G1BL:RNAi | |||||
| Sequence_info | DNA_text | actcgaaagcttcggattcatcgtcgatcagcgatcaccaaactgccgatctcagcattttcaacggatccttcgatggaggtgcattctcatcgtccaacattcctctgttcaacttcatgggaactgggaaccagcgcttccaatactcgccacatccatttgccaagtcgagtgatccgtgtcgtctggctgccttgacaccgtctacaccgaaaggcccattgaacttgactcctgctgactttgggcttgccgatttttccgttggaaacgagtcgtttgccgatttcaccgccaacaatacgtcattcgttggaaacgtccagagcaatgttcgatcaacccgtcttttgcctgcctgggctgtcgacaacagcggaaacattcgggatgacctcactctccaagatgttgttagcaacggatcgcttatcgatttcgctatggatagaactggagtcaagttcctgga | |||
| gacggagggcttttggtcatgtgcaaggataaattcgcatgtcgagttgtgcagttggctctgcagaaattcgaccattccaacgtcttccagctcatccaagagctcagcacattcgacctggcggcaatgtgcactgatcaaatctcgatccacgtgattcaacgtgtcgtcaagcaacttccagttgacatgtggacctttttcgtgcatttcctctcgtcaggagattcactgatggccgtgtgccaggacaagtatggatgtcgtctcgtgcaacaggtcatcgatagactcgccgagaatcccaagctcccgtgtttcaaattccgtattcaattgttgcattctctgatgacgtgtatcgtccgcaactgctaccggctgtcttccaacgagttcgccaactacgtcatccaatacgtcatcaaatcgtcgggcatcatggaaatgtacagagacactatcatcgataaatgcctgctccgtaacttgctctcaatgtcacaggacaagtacgcgtcgcacgtcatcgagggagcgttcttgtttgcaccgcccgcgttgcttcacgagatgatggaggagattttcagtggatat | |||||
| Experiment | Laboratory | TE | |||
| Date | 02 Dec 2006 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Temperature | 20 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F54C9.8 | Inferred_automatically | RNAi_primary | |
| B0273.2 | Inferred_automatically | RNAi_primary | |||
| F18A11.1 | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004241 | Inferred_automatically | RNAi_primary | ||
| WBGene00004243 | Inferred_automatically | RNAi_primary | |||
| WBGene00004242 | Inferred_automatically | RNAi_primary | |||
| Transcript | F54C9.8.1 | Inferred_automatically | RNAi_primary | ||
| B0273.2.1 | Inferred_automatically | RNAi_primary | |||
| F18A11.1.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000009193 | ||||
| Reference | WBPaper00029045 | ||||
| Phenotype | WBPhenotype:0000037 | Remark | lack egg shell | ||
| Penetrance | Range | 83 | |||
| WBPhenotype:0000351 | Penetrance | Range | 91 | ||
| WBPhenotype:0000867 | Penetrance | Range | 91 | ||
| WBPhenotype:0001028 | Remark | embryos contain nuclei that were abnormal in size | |||
| WBPhenotype:0001130 | Remark | embryos with more than one nucleus had no detectable or incomplete cellularization | |||
| Penetrance | Range | 88 | |||
| WBPhenotype:0001143 | Penetrance | Range | 88 | ||
| Method | RNAi |
