WormBase Tree Display for Rearrangement: eDf18
expand all nodes | collapse all nodes | view schema
eDf18 | Type | Deletion | |||
---|---|---|---|---|---|
Phenotype (3) | |||||
Reference_strain | WBStrain00004509 | ||||
Remark | =e2038 | ||||
The left endpoint of eDf18 was mapped by PCR to an interval encompassing the adjacent cosmids K07H8 and F35H10. More specifically we found that eDf18 does not delete primers in F20D12, F57H12, C26B2, F42G8, C07G1, T09A12, K07H8 (5'GTGAATGCGTCCACGATGAAG and 5'CTACTTTCCTAACACTTCGCGC), but deletes primers in F35H10 (5'AGTCTCTGTACTGCTTGTTTCC and 5'CCGCTTATCTTACACTATTCAG), D2096 and T26A8. | Person_evidence | WBPerson351 | |||
Isolation | Author | JH | |||
Mutagen | ems | ||||
Map | IV | Ends | Left | 3.69533 | |
Right | 4.19861 | ||||
Positive | Gene_inside | WBGene00001413 | |||
WBGene00006914 | |||||
Negative | Gene_outside | WBGene00003492 | |||
Mapping_data | Pos_neg_data (34) | ||||
Display | Hide_under | eDf19 | |||
Strain | WBStrain00004509 | ||||
WBStrain00004564 | |||||
Reference | WBPaper00003144 | ||||
WBPaper00001709 | |||||
WBPaper00002305 | |||||
WBPaper00003883 | |||||
WBPaper00002340 | |||||
WBPaper00015245 | |||||
WBPaper00002958 | |||||
WBPaper00001477 | |||||
WBPaper00016382 | |||||
WBPaper00003719 | |||||
WBPaper00000922 | |||||
WBPaper00003186 | |||||
WBPaper00001833 | |||||
WBPaper00002446 | |||||
WBPaper00013704 | |||||
WBPaper00015109 | |||||
WBPaper00021648 | |||||
WBPaper00002181 | |||||
WBPaper00003014 | |||||
WBPaper00005930 | |||||
WBPaper00001956 | |||||
WBPaper00002843 | |||||
WBPaper00002868 | |||||
WBPaper00003145 | |||||
WBPaper00001669 | |||||
WBPaper00005540 |