WormBase Tree Display for Variation: WBVar00143019
expand all nodes | collapse all nodes | view schema
WBVar00143019 | Evidence | Paper_evidence | WBPaper00005152 | |||
---|---|---|---|---|---|---|
WBPaper00005325 | ||||||
Name | Public_name | e185 | ||||
Other_name | CE54061:p.Cys185Tyr | |||||
F48E8.1a.1:c.554G>A | ||||||
F48E8.1c.1:c.554G>A | ||||||
CE01953:p.Cys185Tyr | ||||||
F48E8.1b.1:c.554G>A | ||||||
CE29046:p.Cys185Tyr | ||||||
HGVSg | CHROMOSOME_III:g.5476405G>A | |||||
Sequence_details | SMap | S_parent | Sequence | F48E8 | ||
Flanking_sequences | ttgtctgggcaaagacgaatctcgtcggat | cggcttctcccgttgccgtgacgttcaggg | ||||
Mapping_target | F48E8 | |||||
Type_of_mutation | Substitution | g | a | |||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Strain (17) | ||||||
Laboratory | CB | |||||
Status | Live | |||||
Affects | Gene | WBGene00003055 | ||||
Transcript | F48E8.1b.1 (12) | |||||
F48E8.1c.1 (12) | ||||||
F48E8.1a.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | |||||
SIFT | 0 | deleterious | ||||
PolyPhen | 1 | probably_damaging | ||||
HGVSc | F48E8.1a.1:c.554G>A | |||||
HGVSp | CE01953:p.Cys185Tyr | |||||
cDNA_position | 597 | |||||
CDS_position | 554 | |||||
Protein_position | 185 | |||||
Exon_number | 6/8 | |||||
Codon_change | tGc/tAc | |||||
Amino_acid_change | C/Y | |||||
Interactor | WBInteraction000009116 | |||||
WBInteraction000503035 | ||||||
WBInteraction000537301 | ||||||
Genetics | Interpolated_map_position | III | -1.62777 | |||
Mapping_data | In_2_point | 276 | ||||
579 | ||||||
2725 | ||||||
3796 | ||||||
3797 | ||||||
5516 | ||||||
6014 | ||||||
7160 | ||||||
In_multi_point | 77 | |||||
90 | ||||||
276 | ||||||
326 | ||||||
355 | ||||||
378 | ||||||
389 | ||||||
407 | ||||||
483 | ||||||
494 | ||||||
496 | ||||||
497 | ||||||
504 | ||||||
507 | ||||||
557 | ||||||
558 | ||||||
559 | ||||||
586 | ||||||
590 | ||||||
755 | ||||||
858 | ||||||
859 | ||||||
867 | ||||||
869 | ||||||
875 | ||||||
876 | ||||||
879 | ||||||
1091 | ||||||
1092 | ||||||
1096 | ||||||
1098 | ||||||
1101 | ||||||
1102 | ||||||
1107 | ||||||
1410 | ||||||
1411 | ||||||
1444 | ||||||
1487 | ||||||
1488 | ||||||
1490 | ||||||
1498 | ||||||
1501 | ||||||
1716 | ||||||
1723 | ||||||
1724 | ||||||
1725 | ||||||
1865 | ||||||
2019 | ||||||
2056 | ||||||
2058 | ||||||
2075 | ||||||
2101 | ||||||
2180 | ||||||
2181 | ||||||
2182 | ||||||
2183 | ||||||
2184 | ||||||
2185 | ||||||
2407 | ||||||
2741 | ||||||
2743 | ||||||
3304 | ||||||
In_pos_neg_data | 803 | |||||
1590 | ||||||
Description (2) | ||||||
Reference (12) | ||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||
Method | Substitution_allele |